Fungi Associated with the Deterioration of Zea Mays L. (Maize) From Market Stores in Abeokuta, Ogun State, Nigeria.

Fungi Associated with the Deterioration of Zea Mays L. (Maize) From Market Stores in Abeokuta, Ogun State, Nigeria.

¹Jonathan, SG*; ¹Eguavon MI;²Omeonu FC ; ³Ade-Ogunnowo FE; ¹Olabanji IT ^{; 1}Oladayo IA and  ¹Salaam SM

¹Myco-Pathology & Applied Microbiology Group, Department of Botany, University of Ibadan

²Department of Microbiology, College of Natural and Applied Sciences, Chrisland University, Abeokuta,

³ Department of Biological Sciences, Tai Solarin University of Education, Ijagun Ijebu Ode. Nigeria

*Corresponding Author

DOI: https://doi.org/10.51584/IJRIAS.2025.10030063

Received: 10 March 2025; Accepted: 19 March 2025; Published: 20 April 2025

ABSTRACT

This study addressed the characterization of fungi associated with fungal contamination of maize. The diversity of fungal species responsible for maize spoilage necessitates effective control measures; however, their efficacy remains uncertain. Molecular identification of fungal populations provides essential data for predicting disease incidence and assessing potential risks. Accurate characterization of fungal species is crucial for identifying pathogenic strains in maize samples. Stored maize samples were obtained from four markets in Abeokuta- Kuto, Lafenwa, Olomore, and Osiele. Samples were labeled according to their locations. Fungal isolations were performed using the serial dilution method on Potato Dextrose Agar (PDA). Microscopic identification was based on colony morphology. molecular and macroscopic analyses confirmed 100% fungal contamination in all maize samples. The predominant fungal genera identified included Aspergillus, Fusarium, Rhizopus, Penicillium, Mucor, and Cladosporium species. The prevalence of these fungi was consistent across all the sampled locations, highlighting their widespread occurrence in stored maize from Abeokuta markets. The significance of these results were discussed.

Keywords: Food safety, Zea mays, contamination, molecular identification, fungi

INTRODUCTION

Food safety concerns have heightened awareness of fungal infections and their detrimental impact on food quality (Asemoloye et al.,2017). Maize (Zea mays), a staple food for humans and a key ingredient in animal feed, is highly susceptible to fungal contamination, leading to economic losses and health risks (Sobowale et. al.,2007;Serena-Saldivar, 2016 ;Jonathan,2019). Due to its widespread consumption and diverse applications in food production, maize is a vital agricultural commodity in the global food market. However, maize is highly susceptible to microbial contamination, primarily caused by fungi, bacteria, yeast, and insect infestations, which contribute significantly to post-harvest spoilage and economic losses (Akinfemi et..al,.2009; Nelson et al., 2019; Jonathan et. al.,2023).

Fungal contamination of maize poses serious health risks due to the production of mycotoxins—secondary metabolites synthesized by specific fungal species. Mycotoxins such as aflatoxins, fumonisins, and ochratoxins are highly toxic to humans and animals, leading to various health disorders (Pitt & Hocking, 2002). The presence of spoilage fungi in stored maize can result in significant deterioration, including discoloration, fermentation, acidification, and structural degradation, rendering the grains unsuitable for consumption (Jonathan et. al.,2025; Pitt & Hocking, 2009).

Maize is widely valued for its high nutritional content and adaptability, making it an essential crop for ensuring food security. However, fungal contamination threatens both its quality and economic value. The prevalence of spoilage fungi, including Aspergillus, Fusarium, Penicillium, and Alternaria, has been well documented, highlighting the need for effective monitoring and management strategies (IARC, 2002).

Spoilage fungi have posed a persistent threat to food safety throughout agricultural history. These fungi manifest in various forms, including fuzzy growths, powdery residues, and slimy coatings, exhibiting a wide range of colors from white and black to green, orange, red, and brown. Their proliferation leads to biochemical changes in maize, compromising its sensory and nutritional qualities (Pitt & Hocking, 2002, Jonathan et.,al.,2025). Unchecked fungal growth contributes to food acidification, fermentation, and decomposition, ultimately reducing the market value of maize and increasing health risks for consumers.

Since the 1960s, increased awareness of pathogenic fungi has reinforced the significance of fungal contamination as a major agricultural concern. Fungal spoilage is no longer considered a minor issue but a critical challenge in food storage and public health. Aspergillus, Fusarium, Penicillium, and Alternaria species are among the most commonly identified fungal contaminants in maize, with their occurrence frequently linked to storage conditions, humidity levels, and temperature variations (IARC, 2002; Gbolagade et. al.,2006).

The deterioration of maize due to fungal contamination presents significant agricultural and economic challenges, necessitating the development of effective prevention and control measures. However, the efficacy of existing strategies remains uncertain. To address this issue, it is essential to investigate the isolation, identification, and characterization of fungi associated with maize spoilage. Understanding the diversity and pathogenic potential of fungal species affecting stored maize is crucial for implementing targeted control strategies that minimize contamination risks.

Therefore, this study aims to characterize the fungal species responsible for maize spoilage, providing valuable insights into their prevalence, distribution, and potential mitigation strategies. By identifying the factors contributing to fungal contamination, targeted management approaches can be developed to safeguard maize quality and ensure its safety as a critical agricultural commodity.

MATERIALS AND METHODS

Sample collection and preparation

Stored maize (Zea mays) grain samples were obtained from four different vendors across four distinct markets in Abeokuta, Ogun State, Nigeria. The collected samples were systematically separated and labeled according to their respective locations: Kuto (7.1384°N, 3.3499°E), Lafenwa (7.0914°N, 3.3265°E), Olomore (7.1485°N, 3.3509°E), and Osiele (7.1933°N, 3.4533°E).

Preparation of Fungi culture media

Thirty-nine grams of Potato Dextrose Agar (PDA) was weighed and transferred into a conical flask containing 1000 mL of distilled water. The mixture was homogenized in the water bath, and then autoclaved at 121°C at pressure of 1.02kgcm^-2 for 15 min. After autoclaving, the PDA was allowed to cool to 45⁰C before it was dispensed into 100mm Petri dishes. Streptomycin sulphate 5mg/1000cm³ was added to inhibit bacterial growth. The laboratory bench used for media preparation was sterilized with cotton wool soaked 95% ethyl alcohol (Jonathan et. al.,2023).

The prepared PDA plates were used for fungal isolation from maize samples. Serial dilution was employed for fungal isolation following the method described by Jonathan et al. (2016). The inoculated plates were sealed and incubated at room temperature for five days. All experiments were conducted in triplicate to ensure reproducibility. 

Isolation of fungi from Corn samples

Fungal isolation from maize samples was performed using the serial dilution method. A 1 g portion of the maize sample was suspended in a test tube containing 9 mL of sterile distilled water, thoroughly mixed, and appropriately labeled. Subsequently, 1 mL of the suspension was transferred into a second test tube containing 9 mL of sterile distilled water to obtain a 10⁻¹ dilution. This process was repeated sequentially to prepare further dilutions of 10⁻², 10⁻³, and 10⁻⁴. A 1 mL aliquot from each dilution was aseptically inoculated onto solidified Potato Dextrose Agar (PDA) plates. The plates were then sealed and incubated at room temperature for five days, with daily monitoring for fungal growth. All inoculations were performed in triplicate to ensure experimental reliability (Jonathan et al., 2016).

Identification of Fungal isolates and contamination

Macroscopic identification of fungal isolates was conducted based on colony characteristics observed on Potato Dextrose Agar (PDA). Microscopic examination was performed using the wet mount technique with lactophenol cotton blue staining. A sterile inoculating needle was used to transfer a portion of mycelial from the culture plate onto a clean, grease-free glass slide containing a drop of saline water. The fungal mycelia were carefully teased apart to ensure proper separation. A drop of lactophenol cotton blue stain was then added to the preparation, which was subsequently covered with a clean cover slip. The stained preparation was examined under a microscope to assess morphological characteristics, including colony color, shape, texture, pigmentation, and hyphal arrangement (Jonathan,2019).

Fungal isolates purification

Morphologically distinct fungal colonies observed on the PDA plates were carefully selected using a sterilized inoculating needle and transferred onto fresh PDA plates for further culturing. The inoculated plates were incubated at room temperature for five days to promote fungal growth.Purification of fungal isolates was achieved through subculturing by excising the mycelial tips and transferring them onto fresh PDA plates. This process was repeated as necessary until pure cultures were obtained (Okpewho,et al.,2024) .

DNA extraction and polymerase chain reaction

DNA extraction and PCR analysis for genetic sequencing were conducted at Inqaba Biotech, Ibadan, Oyo State, following the standard protocols established by the facility. Fungal isolates were identified using the Internal Transcribed Spacer (ITS) region. Amplification of the ITS target region was performed using the universal primers ITS1 and ITS4, following the method described by White, Bruns, Lee, and Taylor (1960). The obtained sequences were analyzed through BLAST searches in the GenBank database to determine their homology with previously identified fungal sequences.

Molecular identification of fungi isolates

The extracted DNA was sequenced in both forward and reverse directions. The resulting DNA sequences were analyzed using the Basic Local Alignment Search Tool (BLAST) on the National Center for Biotechnology Information (NCBI) database to facilitate the identification of individual fungal isolates.

Fungal DNA extraction, gene application and sequencing

The fungal ITS1-4 region was amplified using the primer set ITS1 (TCCGTAGGTGAACCTGCGG, forward) and ITS4 (TCCTCCGCTTATTGATATGC, reverse) through polymerase chain reaction (PCR). Each reaction contained 4 µL of a 10–50 ng DNA sample, 25 µL of master mix (comprising DNA polymerase, dNTPs, MgCl₂, and reaction buffers at optimal concentrations for efficient DNA amplification), 0.5 µL of each primer, and 20 µL of nuclease-free water to achieve a total reaction volume of 50 µL.

Amplification was carried out in thermal cycling tubes placed in a C1000 Touch thermocycler (Bio-Rad, USA) using the following cycling conditions: an initial denaturation at 95°C for 5 minutes, followed by 36 cycles of denaturation at 94°C for 30 seconds, primer annealing at 58°C for 30 seconds, and elongation at 72°C for 45 seconds. A final extension step was performed at 72°C for 10 minutes. The PCR amplicons were separated by gel electrophoresis on a 1.5% agarose gel and visualized under UV light. Purified DNA fragments were analyzed for quantity using an ABI PRISM 3700XL Genetic Analyzer (Applied Biosystems, Thermo Fisher Scientific, Wilmington, DE, USA). DNA purity was determined by measuring the ratio of UV absorbance at 260 nm to 280 nm, while DNA quality was assessed using gel electrophoresis on a 1% agarose gel.

Number of visible fungal isolates

The total number of visible fungal colonies isolated from each medium was calculated using the formula:

Total Colony Count= (Number of Colonies× Dilution Factor) ÷Volume of Inoculum

RESULTS

Plate 1: Fusarium graminearum obtained from Corn sample on PDA, Plate 2: Aspergillus niger obtained from Corn sample on PDA

Table 1: Morphological characteristics of isolated Fungus on PDA

Table 2: Showing frequency of visible Isolates

Table 3: Putative Taxonomic affinities of sequence types inferred from BLAST search of ITS sequences

Table 4: Showing counts of isolated species present and their location

KEY WORDS: present= +

                         Absent= –

Figure 1: Frequency of Isolates

Figure 2: Dendogram showing phylogenetic tree of isolated strains of fungi.

The Internal Transcribed Spacer (ITS) polymerase chain reaction (PCR) analysis performed on the 10 fungal isolates using ITS1 and ITS4 primers confirmed the presence of fungal contamination in all samples. A total of 10 fungal species were isolated from Potato Dextrose Agar (PDA) cultures and identified using both macroscopic and molecular methods from the four maize samples collected from various market locations. The 10 fungal isolates belonged to six genera: Aspergillus, Fusarium, Rhizopus, Penicillium, Cladosporium, and Mucor spp. Among the sampled markets, Kuto exhibited the highest fungal diversity compared to the other locations, as presented in Table 4. The frequency of maize contamination was highest in Kuto market (90%), followed by Lafenwa market (80%), Osiele market (60%), and Olomore market (40%). Table 1 provides the morphological characteristics of Aspergillus and Fusarium spp.

DISCUSSION

This study identified Aspergillus as the dominant fungal genus in the studied  maize samples, followed by Fusarium, Penicillium, Rhizopus, Cladosporium, and Mucor. The prevalence of these fungal genera was consistent across all sampling locations. The successful amplification of all 10 fungal isolates using ITS1 and ITS4 primers confirmed their fungal identity. Identification based on colony characteristics, such as growth pattern, shape, and pigmentation, provided valuable insights into distinguishing the different fungal species( Okpewho,2024)

The presence of diverse fungal species in stored maize across the four market locations highlights a critical concern regarding fungal contamination. This contamination is primarily attributed to inadequate and improper storage conditions, exposure to fungal spores from the environment, and contamination from storage facilities, transportation, and handling practices. These factors influence the rate and extent of fungal infection in maize grains.

The findings of this study align with the work of Conrad et al. (2012), who reported that the Internal Transcribed Spacer (ITS) region has the highest probability of successful fungal identification across a broad range of species. The use of cultural and morphological characteristics for fungal identification, including colony growth patterns, conidial morphology, and pigmentation, is consistent with the findings of Tafinta (2013), who demonstrated that these features are reliable for fungal classification.

Furthermore, the fungal species identified in the maize samples, predominantly Aspergillus, Fusarium, and Penicillium, corroborate the findings of Chulze et al. (2003), who reported the presence of Aspergillus flavus, Aspergillus niger, Fusarium moniliforme, and Penicillium species in spoiled maize in Argentina. Similarly, Dalcero et al. (2004) identified Fusarium verticillioides, Fusarium proliferatum, and Aspergillus flavus as major contributors to kernel rot and fumonisin contamination in stored maize in Argentina.

Additionally, this study aligns with the findings of Wang et al. (2019), who identified Aspergillus, Fusarium, and Penicillium as dominant fungal species contributing to fungal community dynamics and mycotoxin accumulation in stored maize in China. Li et al. (2020) also characterized fungal communities in stored maize kernels from different regions of China and reported the dominance of Aspergillus, Fusarium, and Penicillium genera.

CONCLUSION AND RECOMMENDATIONS

This study confirmed that stored maize in the investigated market locations is significantly contaminated with fungal species, with Aspergillus, Fusarium, and Penicillium being the most predominant genera. The successful amplification of fungal DNA using ITS1 and ITS4 primers validated the fungal identities, while morphological and molecular analyses provided complementary insights into species characterization. The presence of these fungi indicates that inadequate storage conditions, environmental exposure, transportation, and handling practices contribute to fungal contamination.These findings emphasize the urgent need for improved post-harvest management to mitigate fungal infections, which can lead to spoilage and potential mycotoxin production. To minimize contamination, proper storage measures such as moisture control and aeration should be implemented. Training programs for farmers and handlers on best agricultural and storage practices are essential. Routine monitoring of fungal contamination and mycotoxin levels should be conducted to ensure food safety. Additionally, the use of antifungal treatments, including natural and synthetic agents, can help suppress fungal growth. Strengthening public awareness and enforcing food safety regulations are also critical steps. Finally, further research should explore the use of biocontrol agents and alternative storage methods to prevent fungal proliferation and mycotoxin accumulation.

REFERENCES

1. Akinfemi A,Babayemi OJ and Jonathan SG (2009). Bioconversion of maize husk into value added ruminant feed by using white-rot fungus. Revista Cientifica UDO Agricola 9 No. 4 972-978.
2. Asemoloye MD, Jonathan SG,Saddaf R,Zaffar Habiba,Edward Ehidiabhen Okoawo and Tunde Sheriffdeed Bello(2017).Incidence and Chemical Implications of Aflatoxins in street Vended Foods in Aflatoxin-Control,Analysis Detection and Health Intech. Janeza 153-174
3. Conrad L. S., Keith A. S., Sabine H. and David S. (2012). Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for fungi. 109(16): 6241-6246.
4. Dalcero, A. M., Etcheverry, M. and Guzman, C. A. (2004). Incidence and biodiversity of fungal species causing kernel rots and fumonisin contamination in stored maize in Argentina. J Chulze, S. N., Magnoli, C. E. and Palazzini, J. M. (2003). Fungal deterioration of stored yellow corn. Mycopathologia, 156(4): 275-281.Journal of Agricultural and Food Chemistry, 52(26): 7247-7251.
5. Gbolagade Jonathan;Adetola Ajayi; Ikpebivie Oku, and Donbebe Wankasi (2006). Nutritive value of common wild edible mushrooms from southern Global Journal of Biotechnology and Biochemistry 1(1):16-21
6. IARC (International Agency for Research on Cancer). (2002). Some Traditional Herbal Medicines, Some Mycotoxins, Naphthalene and Styrene. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, 82. Lyon, France: IARC.
7. Jonathan, S. G., Adeniyi, M. A., and Asemoloye, M. D. (2016). Fungal Biodeterioration, Aflatoxin Contamination, and Nutrient Value of (Suya Spices), Scientifica. Article ID Jonathan SG (2019). Fungi Here, Fungi There, Fungi Everywhere: unique and unparalleled contributions of fungi to environment, food production and medicine-. Inaugural University of Ibadan.Ibadan .Nigeria .ISBN978-978-8529-88-0. (91.
8. Jonathan SG Ganiyat B. Abdulrauf Oluwatosin B. Ogunsanwo and Michael D. Asemoloye (2023)..Influence of Pepper Additive and Packaging Styles on Nutrient, Fungi and Aflatoxin Compositions of Stored ‘Robo’ (Deffatted Melon Snack) Journal of Nutrition Food Science and Technology 4 (3) 1 – 13.
9. Jonathan SG,Okunola TT,Nwokolo VM,Omeonu FC,Adegoke BA and Salaam SM(2025).Challenges confronting Plant disease Management in Nigeria .Journal of Agriculture and Aquaculture .7(1):1-7. Escientific Publishers.
10. Li, W., Wu, J., Li, S. and Xu, J. (2020). Characterization of fungal communities in stored maize kernels from different regions of China. Frontiers in Microbiology, 11: 1841.
11. Nelson, P. E., Toussoun, T. A., and Marasas, W. F. O. (2019). Fusarium Species: An Illustrated Manual for Identification. Pennsylvania, PA: Pennsylvania State University Press.
12. Okpewho OP,Jonathan S.G., NwaokoloVM., Asemoloye,MD,Fashae,KF.(2024). Influence of storage temperature on the proximate composition and aflatoxin contents of ‘dankwa. International Journal of Innovative Food, Nutrition & Sustainable Agriculture 12(2):90-97
13. Pitt, J. I. and Hocking, A. D. (2002). Fungi and Food Spoilage. Springer Science and Business Media.
14. Pitt, J. I. and Hocking, A. D. (2009). Fungi and Food Spoilage. In Fungi and Food Spoilage. Springer Science and Business Media 1-22 pp.
15. Serna-Saldivar, S. O. (2016). Cereal Grains: Properties, Processing, and Nutritional Attributes. Boca Raton, FL: CRC Press.
16. Sobowale,AA,Cardwell,K.F:Odebode,A.C;Brandyopadhyay and S.G.Jonathan (2007).Persistense of Trichoderma species within maize stem against Fusarium verticillioides .Archives of Phytopathology and Plant 40:3 215-231
17. Tafinta I. Y., Shehu K., Abdulganiyyu H. A. M. and Usman A. (2013). Isolation and identification of fungi associated with the spoilage of sweet orange (Citrus sinensis) fruits in Sokoto state. Niger. Journal of Basic Applied Scientific, 21(3): 193-196.
18. Wang, G., Liu, X., Li, H., Wang, C. and Xu, J. (2019). Fungal community dynamics and mycotoxin accumulation during maize storage. Food Microbiology, 80: 46-53.